| Registro completo |
| Provedor de dados: |
Genet. Mol. Biol.
|
| País: |
Brazil
|
| Título: |
Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers
|
| Autores: |
Destéfano,Ricardo Henri Rodrigues
Destéfano,Suzete A. Lanza
Messias,Claudio Luiz
|
| Data: |
2004-01-01
|
| Ano: |
2004
|
| Palavras-chave: |
Metarhizium anisopliae
Entomopathogenic fungi
PCR-RFLP
ITS region
|
| Resumo: |
In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S- ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E9, B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E9, B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.
|
| Tipo: |
Info:eu-repo/semantics/article
|
| Idioma: |
Inglês
|
| Identificador: |
http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1415-47572004000200020
|
| Editor: |
Sociedade Brasileira de Genética
|
| Relação: |
10.1590/S1415-47572004000200020
|
| Formato: |
text/html
|
| Fonte: |
Genetics and Molecular Biology v.27 n.2 2004
|
| Direitos: |
info:eu-repo/semantics/openAccess
|
